Please use this identifier to cite or link to this item: https://repositorio.ifgoiano.edu.br/handle/prefix/915
metadata.dc.type: Trabalho de Conclusão de Curso
Title: OCORRÊNCIA E IDENTIDADE MOLECULAR DO CARVÃO-DO-CAPIM-AMARGOSO (Digitaria insularis) UTILIZANDO REGIÕES ITS do rDNA E ß-TUBULINA
metadata.dc.creator: Neves, Paula Rodrigues
metadata.dc.contributor.advisor1: Lima, Milton Luiz da Paz
metadata.dc.contributor.referee1: Guimarães, Gesiane Ribeiro
metadata.dc.contributor.referee2: Jesus, Jéssica Maria Israel de
metadata.dc.contributor.referee3: Lima, Milton Luiz da Paz
metadata.dc.description.resumo: Resumo – Os fungos causadores carvões que afetam plantas daninhas são pouco estudados dado ao imenso foco e reconhecimento de interações de fitopatógenos sobre plantas cultivadas, mesmo sendo uma importante fonte de sobrevivência de fitopatógenos. O objetivo deste trabalho foi identificar, diagnosticar e sequenciar regiões conservadas do agente causal do carvão-do-capim-amargoso. Amostras de capim-amargoso apresentando sintomas de chicote e colapso da folha principal foram analisadas. Preparou-se lâminas semipermanentes, para caracterização morfológica, morfométrica e registros macro e microfotográficos. Coletou-se ustilósporos para extração do DNA, amplificação utilizando primers ITS-1[TCCGTAGGTGAACCTGCGG], ITS-4 [TCCTCCGCTTATTGATATGC], Bt2a[GGTAACCAAATCGGTGCTGCTTTC] e Bt2b [ACCCTCAGTGTAGTGACCCTTGGC] e sequenciamento. Os soros apresentaram perídios compostos por células fúngicas, filiformes ou delgadas, os ustilósporos algumas vezes agrupados, esféricos, de diâmetros 8,4-(6,4) -3,1μm, dimórficos, com ausência de células estéreis entre os “spore balls”. As sequências foram comparadas com aquelas depositadas no gene Bank do “National Center for Biotechnology Information’s”. A região ITS produziu amplicons de 700 bp, e o gene que amplifica a região conservada b-tubulina produziu um amplicon de 520-710 bp. A análise morfológica e filogenética apontou que o isolado detectado no município de Urutaí, GO, como pertencente a espécie Sporisorium panici-leucophaei (Ustilaginales, Ustilaginaceae) somente registrado na Oceania, Sul do Brasil e continente Africano até o presente.
Abstract: Coal-causing fungi affecting weeds are poorly studied. Given the immense focus and recognition of plant pathogen interactions on plants cultivated, even though it is an important source of phytopathogen survival. The goal the aim of this work was to identify, diagnose and sequence conserved regions of the causative agent from the bitter grass. Samples of bitter grass showing symptoms of whip and collapse of the main leaf were analyzed. Semipermanent slides were prepared, for morphological, morphometric characterization and macro and microphotographic records. Ustyllospores were collected for DNA extraction, amplification using ITS-1 primers. [TCCGTAGGTGAACCTGCGG], ITS-4 [TCCTCCGCTTATTGATATGC], Bt2a [GGTAACCAAATCGGTGCTGCTTTC] and Bt2b [ACCCTCAGTGTAGTGACCCTTGGC] and sequencing. The sera presented peridium composed of fungal, filiform cells. Or thin, the sometimes clustered spherical ustilospores of diameters 8.4- (6.4) -3.1 μm, dimorphic, with no sterile cells between spore balls. The sequences were compared to those deposited in the Bank gene of the National Center for Biotechnology Information’s”. The ITS region produced 700 bp amplicons, and the gene that amplifies the region Preserved b-tubulin produced a 520-710 bp amplicons. Morphological analysis and phylogenetic analysis pointed out that the isolate detected in the municipality of Urutaí, GO, as belonging to Sporisorium panici-leucophaei (Ustilaginales, Ustilaginaceae) species only recorded in Oceania, Southern Brazil and the African continent to the present.
Keywords: Identificação molecular
Parasita obrigatório
Sporisorium panici-leucophaei
metadata.dc.subject.cnpq: Ciências Biológicas
Ciências Agrárias
metadata.dc.language: por
metadata.dc.publisher.country: Brasil
Publisher: Instituto Federal Goiano
metadata.dc.publisher.initials: IF Goiano
metadata.dc.publisher.department: Campus Urutaí
metadata.dc.rights: Acesso Restrito
URI: https://repositorio.ifgoiano.edu.br/handle/prefix/915
Issue Date: 19-Dec-2020
Appears in Collections:Licenciatura em Ciências Biológicas

Files in This Item:
File Description SizeFormat 
TCC__Paula Rodrigues Neves PDF (2).pdf538,34 kBAdobe PDFView/Open


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.